01-Salehzadeh-JAPB Final Edition-P 1-14

Kích thước: px
Bắt đầu hiển thị từ trang:

Download "01-Salehzadeh-JAPB Final Edition-P 1-14"

Bản ghi

1 1394.$ MCF-7 +, - Oscillatoria sp. $'( )* $%& 3 /' 0 94 : + $! $ +(6$ 7 78 * -&34 +,* $1'& :! "! #$ %& '() (&* * 7 * #. 6#7+.#& &./& 0! 01,. #1 *<& 0 #* &*9& * ( 6#:$+ 4; '() #$& #(. 2 8 #$& #( 82 *(& 0$2 =.> # &?+! + & * 1*! 8. #).? %& $* ;.& 4:(2 '() 102.$(. & + D 8.& & 01B.? #! Oscillatoria 0+ :&.> 02.$( #?C)*(1 $. C& 6#$ 01B.? 8I> ; 6H7 F1*G.$(E 01B.?. # MCF B.? (CASP3) 3!J2 K ( * #$ 62/5 61/2 60/6 60/3 60/15 60/075 01/?P Oscillatoria #?C)*(1 8I> O. #$ * MTT assay O. 1B.? #! 8I> (;.$ ( ()#?(& X3#?(& 10 * 5 F\ (_1. 2 Z$ F1*G [$. # Real Time PCR O. 3!J2 K ( 4((Y Z$ 1 :$ 0 #"&. > 24 &! $.$ :$ 0 #"& ],^ * 2 ( F12 1B.? #! 6/?P 3!J2 K ( 2 Z$ Real Time PCR [$. F\ 1 $.$.Oscillatoria 63!J2 6 :7,' 9 & 6Y& 6#&,!b 8EZ$ 6Y& 7* 6#! 8*3 6#*C(& 0K.).C.( #2 0.aZ$ #&,!b 8EZ$ 6 7* 6#! 8*3-2. 6Y& 6#&,!b 8EZ$ 6Y& 7* 6#! 8*3-3 :B.c& 8.$ *

2 [2].(Siegel et al., 2015) $(&#& $ \1, m$ d2 0 l3 #(b 01.Z2 9& #)* (1380 6C1 * #l7), \(& F\ 3 1 l # 2 o> 0( #$* d(^ 010(! #C.>. ^ #$ $! ( k (.( \ * ($0!*.$) p.& (& * %& \(& F(.1 #& m #C) (.&.1 * 0( = f..#& E A^ '&.>! * _j 6#?(& _j 6 6#(Y+ 6#2.^ 0 H 0* 60 6#E?&7 \($ 6'C) ]I& * ql #P dk 6#Dl Yassaee et al., 2002; Deep ) 2 8 C?> B,^.(and Agarwal, 2010?(* K 6 #) 4 'D7 #"(:!* a& =($K# * =($K 012*! r7 1K..#& 8 0\ &$ %& 6(sC (& B " 018$(3!* d(/ 61B.? \ * #).? F9$ #!% * 1B.? BI 60(t* 27; (^ 01 1!* F\ 08> 4((Y d(9& A + ea X & #3$! 8.( * Y f.$ 2.+* #"5 ($ * #"5 * & &.+ 6#$+ &! &b g:. 8&b '&> (&* #D*> * #:?D 0(! h Siegel et ) + (& * %& B! #$+ &!.(al., 2016.& \1 600 *.(?(& * %& \1 700 *.(?(& 7 *, Steven et al., ) 8 2 X,> (& + 2 #1.(2013.(?(& =) $8 8 i(jz 6((& * %&.& \1 600 * * ((& * %& $ \1 700 *.(?(& =) \1 400 *.(?(& =) %\ 8 *.(Zhu et al., 2012) ((& * %& $ $ =! Z1 1! 8<& 4k,:&.^ #3$! dd..#& Mousavi et al., ) ("+ $ \1 =! F( 8<& 4k ) 1.(2007 +! IZ *.(?(& IZ *7 "! 2 $.#&,:&

3 [3] *+, -' MCF-7 %&' () Oscillatoria $ O. q+ Xa$ * (c*.(Elmore et al., 2007).#& 1(.3?+! Oscillatoria 02.$( 4:(2 0 2 #102.$( Dixit ) #$(2#$b * 0.&.#$b 4:(2 (_1.(and Suseela, *2 6.C() 61(.2 $1 0E 49Z& 6($(.C( 6(c*#?(.C( 6(.) 6' 6(C) 62.?3 612#? 6J (_ #& (J#? 6((t x.^ 102.$( 8.$^ \3 \($ #?E$ * #ldh 6#2H Andreoli et al., 1986; Freile ) 8 8I> (; F1*G Oscillatoria.(et al., $( #?C)*(1 6 MCF-7 #).? 8 $* #$ 01B.? 0* b #3$! F9$ D #.& 3!J2 K ( 4((Y *. 3 =< -& >?' $'( 2! Oscillatoria sp. 02.$( y. ( ) ( #C:?+\ 2 #& $! Z2 O(<& * ( 4; +..(Fisch et al., 2005) $! 8 6#(( 01* #^ #:$+ '^ * #:$+ 4; 'D7 #"(: &. 3 D +..& #* %& 6#$H 01d($C&! #C 2 #.5. B.? 8 0\ &$ #).? 8 0\ &$ %& d($c&! #?j& 010( 6C$ '> # 81 '(?< 6#.^ 01(?+. 1.^ a f.$ * #:I> #).? 8 0\ &$ %& d($c& 01 *! 0Zb '& * g(d 68(_( %& u?j& (& *. #).C).& #C..+* #).? 8 0\ &$ B.? ea 0* %& 01.J * * 1 #& #).? v^ '&.> 2 *.#& 8(&$ #w (& 2 0E Z$ (^ 01F1*G :). 02.(& p: d1 (& * 2 8..#& d^ 3!J2 p: * 1 2 #+ 01!J2! #C 3!J2 *. B" \().c* ; $.#& %& $.2 B" 1!J2* "AD "AD a& #).? 8 0\ &$ * #).??C \a 6DNA

4 [4] &#$ 25 =, 1B.?! ()#?(& Z2 O(<& ()#?(& 5 * '9& ()b 6Sigma-Aldrich) & RPMI1640 (FBS) 0*3 (+ X ()#?(& 5 81 (?(# ()#?(& X3*C(& % (&. ()#?(& X3*C(& 100 * hj. H ()b 6Sigma-Aldrich) 6Memmert 60() 150 B&) &..C$ * B9$ Z2 ()b 695%. * 5% CO 2 0*7 3#$. 8 Z2 MTT > MTT O. #).? 4(7 \(& " 6 Xa$ 0. # Assay $^ 96 (? 1B.? 6 K *! ".$ '9& ( $^ 1 B.? ) 8I> 1B.? ( &! X! B.?<& 6> 24 4& Oscillatoria ()b 6Sigma-Aldrich) MTT (? * H $^ 96 (? 01=1l 6BTI8 B&)..C$ > 3 4& D 3#$ + 37 ()b 6Memmert. #)^ 1=1l #* B.?<& hj.3 DMSO B.?<& ()*C(& 100 =1l 1. 8 Z2 ()b 6Sigma-Aldrich) 3#$ & 02.$( O < * z.2.) 3500±350.$ 4 #C > 12 * #* > 12 P2! Z2 O(<& hj. 8 0E$.:> &*C(& 0/45 & AD * #5. 8\(?(.() 8 ]5 p.?j& * 8 8 =Z^. X3 3 68I> ( 0 ()#?(& 100 Oscillatoria 02.$( p.?j& ()b 6Sigma-Aldrich) 50% B.$ BTI8 B&..C$ C( 0* * 24! h.3 D ()b 6Memmert). 8.:> #5 P2! p.?j& > B&) 0* 8E 8 ]5 B.?<& 0& ()b 6Memmert 6RE301A-W.. r(?y 3 D 3#$ Memmert 60() 50 B&) *b hj =Z^ 3#$ & ()b. X3#?(& 20 y. ( 0. D Z2 O(<& ()*C(& 10 8I> =Z^. '7 #&b * #H X +(.$ =, >?' #).? =$! MCF-7 #).? 8 = 9&. (..($

5 [5] *+, -' MCF-7 %&' () Oscillatoria $ :1 (%) =, A$ & =1-[(ODE/ODC) 100] }8I> 8 ( 01B.? 0.$ q+ :OD E.1 ( 01B.? 0.$ q+ :OD C =$&$0 +E&$. NCBI#$8E!3!J2K#). National Center for Biotechnology 6b +. * 3 (Information 1. #7 /$.& #). #7 Becon Desingner \ X$ O. #5I^! NCBI BLAST O. * ) '57 ( 1 BI '<&.. 8 &b 1 B*+ 4IjZ&. 0 * H (Dimethyl Sulfoxide) Z2 (? 6MTT F q. 2 '7 O. hj. 8 C 9(D 10 4& (C&b 6Biotek 6Elx800 B&) \k &.$$ 590 v.& B. 1 $.$ 0.$ q+ 1B.? 'C (_1. 0(38!$ 6IX51 B&) 4..C*C(&?(*. # (K 6Olympus 02.$( 8I> ; \(& :<& 0 #$ 01B.? 0* Oscillatoria 01B.? %& \(& # * MCF-7 Poff et ) 8 1 A! 8 ( :(al., I& - =$&$0 G)H? :1 7F JK - )8 &7(& ( >IF) 5ʹ-3ʹ $&$0 ( ʹTGGTTCATCCAGTCGCTTG3ʹ CASPASE3- F ʹATTCTGTTGCCTTTCG3ʹ CASPASE3- R ʹTCCTCCTGAGCCAAGTA3ʹ B-ACTIN- F ʹCCTGCTTGCTGATCCACATCT3ʹ B-ACTIN- R 01/?P MCF B.?. 10 * 5 62/5 61/2 60/6 60/3 60/15 60/ & 8I> ()#?(& X3#?(& RNeasy 8 ()b cdna 2 RNA L&$H& (2! RNA 6Qiagen) vj 0 Plus Mini Kit

6 [6] ( 8E * 1% RNA!3b BK 01B.C).& (2 0*!.*C) D #.& ()b 6Scandrop).$$ (2! 8 cdna (C&b 6Thermo Scientific). hj.3 RevertAid ^ 68 vj RNA 0*! Real Time PCR *! ")A&.& K ( # 0 Real 8E! 8 #a (2 8 (# Bioneer) Time PCR ()*C(& 25 da7 F2* B.?<&. B.?<&. ( x.ij& 01q.( 1! ()*C(& 1 6cDNA ()*C(& 1 '& 12/5 6( * (Z( 01! = 6K( 2)!(? Taq d\$b ()*C(&.. A9& qb ()*C(& 9/5 * ( Real Time PCR 018 \()$b.xa$ $b ^l 9& z 8&b ( 01B.?) $b01 * :<& 1 01 ^l],^6 ")A& F&!b.& ]1 K :$ 6 Ct :<& 2 - Ct 01 $.$! $.$ * (8I> 8 B.&! 8 g! (B-actin) +& K b :<& B.? hj * $.C$ > 01B.? * (8I> 8Z$ ( 01B.?) O. * $ + 8I> 8 ( 2 hj.$ 8.Z () 4 ()b 6Qiagen) RNX Plus ()#?(& 9(D 5 4& 1 $.$ * H 1B.?.3 D 3#$ & X*?2 ()*C(& 400 \(& hj H 1 $.$ ()b 6Sigma-Aldrich) 9(D 15 4& 6 hc*! h. > hj. E$ ~ 0& + 4 0& 9(D * Hettich 6EB21 B&) K.($ 3#$.( =?J #k Fj. ()b ()*C(& 500 * '9& ' ()b 6Sigma-Aldrich) B.$**\ 0& 9(D 5 4& 8* * p.?j& * > 3#$ + 4! 2 v^! h. K.($ 9(D 75% B.$ ()#?(& 1 #(! 6#k 9(D 5 4& 1 $.$ 6 &. H 7500 > 3#$ + 4 0& #*! * $ K.($ 9(D * 30 RNA ^b?7&. v^ 1b * ((2. '7 ' A9& qb ()*C(&

7 [7] *+, -' MCF-7 %&' () Oscillatoria $ #+. 'D 4((Y Oscillatoria (8I> D) 1 01B.? 9& 8 2 a 1B.? #j 01#3G*. Z$ 1B.? #! # [$ 8I> (; < 6> 24! " 2 6Oscillatoria 02.$( #?C)*(1. F12 0! 7 1B.? 09 \(& ()#?(& X3#?(& 10 /?P D* 81Z& 0 #"& ],^ 6> 24! h ()#?(& X3#?(& 0/075 /?P. 1B.? 09 \(& 0* ; d2 8I> :$ 0 #"& ],^ 2 Z$.(1 'C) $ 1 $.$ /?P. 7 6> 24 3! h 8I> ()#?(& X3#?(& 0/4 #! & 6Oscillatoria.(P<0/001) 81Z& 1B.? :2 Ct = CtTarget CtReference Ct = CtTest Sample CtControl Sample Relative Expression: 2 Ct $b ^l ( 4* : Ct } $b ^l :Ct ( 4* : Ct }8 ( * 1 01B.?.8 ( * 1 01B.? 01 Ct (! 8 ")A& 0&b 4:<& \()$b 18 * Xa$ SPSS 16 \ X$ (One Way ANOVA) = h$* 01K ( 4* * 3 D #.& 8 ( * [$. 8 F$ 1 01 $.$ ( * ]1 :<& Tukey s HSD.&!b ("& ]<$ ± (E$(& /$ #"& P<0/05 * $8 MCF-7 02.$( #).? 8 #j [$ M( 8I> 2 Z$

8 [8] Oscillatoria $'( )* $% >8 0.$ MCF-7 =, + :1 N.>* 24 & V0 $+, $ $9+, /5 1/2 0/6 0/3 0/15 0/075 =>O,P 9 1% RNA L&$H& M( :2 N ((2 6B.?! RNA vj! h. # BK 0* 8 vj 01RNA. 28 S * 18 S 01$ 2 'C i(jz 'D eh* RNA. d) 81 Z$ 1$. #+j '(?< * \a! 8&b [$ 3!J2 K ( ((Y E$( 0&b 0/4 /?P 8 ( MCF-7 #).? 8 > 24! " 8I> ()#?(& X3#?(&..

9 [9] *+, -' MCF-7 %&' () Oscillatoria $ 6> 24 # 6(Fold Change) 1 6P<0/001) ((Y 6/59±0/83% \(&.(3 'C K ( :$ 2 Z$ 0&b #! MCF-7 #).? 8 +& K 3!J2 :$ IC 50 /?P 8I> 8 ( Oscillatoria +,& 7= )* $% >8 3 /' G&$X :3 N 6.1 #3.)b?+! #A(<& '&.> #P dk * #3$! 0.E) 6z Komarek, 1973; Miller et ) 2 8! 8.+* 6E #!.(al., 1978 #( 6#7+?+! #$& 01C1 * %& \(& _1 6#. * #$& 2 k,:& ( (&. #$& 01C1 0&b2$ E$( * #$& #( qj& (; 68*,> d(9 B7 #"(: 01B.? 0E$. Y8 018I> 8 ^ 01\&!.>.+* X> 6# 01d($3 1b ; u( #3 3 * #:$+.(Chiheb et al., 2009) 68. ($ '2 $! 01! 1.Z2 s2 0(, * f.( '?>?+!. F\ B7?+.#&, 0."5 ( O:&

10 [10] (sc F12 02.$( 8I> 2 * F9$ d7 $1 #$ 01B.? & o> ()#?(& X3#?(& 220 /?P & <)! 2 #$ 01B.? (sc Kyadari ) 9A& F1*G (sc.(et al., 2014 ijz& 2014 B Wang * Jinhui Microcystin (2 20 /?P Oscillatoria 2 $ 2 02.$( 0 > 48! " ()#?(& X3*C(& 1b.. 1B.? 05 6P53 50 #3Z2 ; 01K ( 2 $ Z$ (_1 E$( &. 2 ((Y bcl-2 * bax 0* $. (2 2 8.?A& 3(; B.? 8 0\ &$ %& '7& 2 a$b!.(jinhui and Wang, 2014) 6 0!..b 01K! d1 3 Jinhui ) 1b * Bing. 9A&!J2 K ")A& H7 F1*G [$ (and Wang, 2014 #$H (; 2010 B F$C1 Nostocaceae 8.$^ ($(.C( (2 # MCF-7 8 0* 2. b! #27 '57 [$.$ 2 8 #).? (sc & o> (2 a& (_1 68 #$ 01B.? * O:& E "&?+! \($ 018 *b! 8. #$& (5^ 0 2 # & 8G* #"(: F\ (^ 1 * 1 #$H!.(Piri and Ordog, 1997).#& # &? Oscillatoria 02.$( #$H 4; + #")A&. 8 Xa$ 0\b 02 B Sivasubramanian * Mukund #).? ( ; 8 2 # # 2014 #).? 8 Oscillatoria 02.$( 2 $ Z$ 6$ Xa$ A595 # b ()#?(& X3#?(& 1000 /?P 01B.? (sc & o> $. > 24 #$ 01B.? 'C * #$ 2 $( a($. ((Y (5^ 0 Oscillatoria 02.$( Mukund and ) #$ H [$ 2 (Sivasubramanian, 2014 * Kyadari. #$.j1 H7 F1*G 8I> ; 2014 B C1 B.? 0* Oscillatoria 02.$(.$ 2 # $ d7 $1 #$ 01 Z$ 1b ")A& MTT [$

11 [11] *+, -' MCF-7 %&' () Oscillatoria $ %& 09) (5^.. B> 3!J2 K.#& 3!J2 K ( F\ * #).? Oscillatoria 8G* 018\(E$ $( 4:(2.+*. :$ 8 & =.> 2 1 #($(.C( ()" * $8 ^ #$H &*9& 2 $ 0.D #$(2#$b (_1.$#& k #$&. 01* 8I> 02#? 4:(2 d( =2 02.$(! 8&b Andreoli ) #\ F9$ #>.(et al., 1986 #2 4")A& 2 Z$ & # 02.$( 8I> ; (&! %& 01K ( Oscillatoria #).? 8 0\.& 02.$( 3 D #.& &$ ! #2$ 0* 8 3 4")A& Xa$ 6 ; d($c& * #$H 01#3G* * #).? (sc & 02.$( 0*H 6#1EZ&!b * #() 01#.!?+! 0^ 4((Y #ZP 4((Y * (&*2 d2 6#?**C(& C1 * Wolf.(Bing et al., 2010) ; 8 2 # # 2008 B Lyngbya majuscula 02.$( 0& $ Xa$ 8!J2 K ( 0* 4:(2?> 02.$( 2 01B.? (sc & a& #$H.(Wolf et al., 2008) 6k 8 01F1*G +. 4; 602.$( 8I> 2.#& u?j& 01 #*& #$H.^! C #).? 8 = 0* #7 * '() 102.$(.1 #& Z$ #! 4; 1 D.$; 4:(2 [$.1 Z$.^! #*& 24 &! 4& 2 E$Z$ 8&b 8$! \(& 68I> /?P F\ 6> 2 #& F12 #$ 01B.? $& %& (& 8I> (; '() k7 4;. #).? 8 0\ &$ #?C)*(1 8I> =(2..( ( F\ g! $.#& Oscillatoria

12 [12] Z Ij& 0*&.1388.\ -&. ((?a&. #C($K# :(4)7 6X. 8\1 =($K Andreoli S.P., Mallet S. and Bergstein M.P Role of glutathione in protecting endothelial cells against hydrogen peroxide oxidant injury. Journal of Laboratory and Clinical Medicine, 108: Bing L., Xianming C.H., Meihua G. and Wuxiu L Apoptotic mechanism of MCF-7 breast cells in vivo and in vitro induced by photodynamic therapy with C- phycocyanin. Acta Biochimica et Biophysica Sinica, 42(1): Chiheb I., Riadi H., Martinez L.J. and Dominguez S Screening of antibacterial activity in marine green and brown macroalgae from the coast of Morocco. African Journal of Biotechnology, 8: Deep G. and Agarwal R Antimetastatic efficacy of silibinin: Molecular mechanisms and therapeutic potential against cancer. Cancer and Metastasis Reviews, 29(3): Dixit R.B. and Suseela M.R Cyanobacteria: Potential candidates for drug discovery. Antonie van Leeuwenhoek, 103: Elmore S Apoptosis: A review $O. +(. +=&$&. +$$E?a&. ( :(5)26#&, of programmed cell death. Journal of Toxicologic Pathology, 35(4): Fisch T., Pury P., Probst N., Bordoni A., Bouchardy C. and Frick H Variation in survival after diagnosis of breast cancer in Switzerland. Annals of Oncology, 16(12): Freile P.N. and Morales J.L Antibacterial activity in marine algae from the coast of Yucatan, Mexico. Botanica Marina, 47: Jinhui L.I. and Wang Q Effect of Microcystin-LR on cell viability and apoptosis-related proteins in primary cultured Sertoli cells for 48h. Life Science Journal, 11(12): Komarek J Culture collections. P: In: Carr N.G. and Whitton B.A. (Eds.). The biology of blue-green algae. Blackwell Scientific Publ. Kyadari M., Fatma T., Velpandian T., Malliga P., Bharat N. and Bano F Antiangiogenic and antiproliferative assessment of cyanobacteria. Indian Jornal of Experimental Biology, 52(8):

13 [13] *+, -' MCF-7 %&' () Oscillatoria $ Miller D.E., Green J.C. and Shiroyama T The Selenastrum capricornatum Printz algal assay bottle test: Experimental design, application and interoperation protocol. Corvallis Environmental Research Laboratory, Office of Research and Development, U.S. Environmental Protection Agency. 126P. Mousavi S.M., Montazeri A., Mohagheghi M.A., Jarrahi A., Harirchi I., Najafi M. and Ebrahimi M Breast Cancer in Iran: An Epidemiological Review. The Breast Journal, 13(4): Mukund S. and Sivasubramanian V Anticancer activity of Oscillatoria terebriformis, cyanobacteria in human lung cancer cell line A549. International Journal of Applied Biology and Pharmaceutical Technology, 5(2): Piri Z.M. and Ordog V Effect of some herbicides commonly used in Iranian agriculture on aquatic food chain. Ph.D. Thesis, Hungarian Academy of Science, 130P. Poff A.M., Ari C., Arnold P., Seyfried T.N. and Agostino D.P Ketone supplementation decreases tumor cell viability and prolongs survival of mice with metastatic cancer. The International Journal of Cancer, 135: Siegel L., Miller D. and Ahmedin J Cancer Statistics, A Cancer Journal for Clinicians, 65: Siegel L., Miller D. and Ahmedin J Cancer Statistics, A Cancer Journal for Clinicians, 66: Steven S., Coughlin S.S. and Cypel Y Epidemiology of Breast Cancer in Women. Springer Science Business Media, New York. 399P. Wolf W., Ainhoa M., Vicente A., Simone S. and Takashi L The marine lipopeptide somocystinamide A triggers apoptosis via caspase 8. Proceedings of the National Academy of Sciences of the USA, 105(7): Yassaee V.R., Zeinali S., Harirchi I., Jarvandi S., Mohagheghi M.A. and Hornby D.P Novel mutation in the BRCA1 and BRCA2 genes in Iranian women with early-onset breast cancer. Breast Cancer Research, 4(4): Zhu L., Pickle L.W. and Ghosh K Predicting US- and statelevel cancer counts for the current calendar year: Part II: evaluation of spatiotemporal projection methods for incidence. Cancer, 118:

14 Aquatic Physiology and Biotechnology Vol. 3, No. 4, Winter 2016 The effect of Oscillatoria sp. cyanobacterium extract on MCF-7 breast cancer cell line and CASP3 gene expression Fatemeh Akbari 1, Ali Salehzadeh 2 *, Mohammad Mahdi Forghani Fard 3 Received: February 2016 Accepted: March 2016 Abstract Breast cancer is the most common cancer and the second leading cause of cancer death in women after lung cancer. Many efforts, including surgery, radiation and chemotherapy, have been made to treat breast cancer. Due to some drawbacks of chemotherapy such as toxicity and drug resistance, some other strategies, including use of marine resources, have recently been developed. Cyanobacteria have some effective compounds that can induce the process of cell death in cancer cells and might be promising candidate for cancer therapy. In the present study, the effect of hydro-alcoholic extract of Oscillatoria cyanobacterium on the viability and gene expression of caspase 3 (CASP3) in MCF-7 breast cancer cell line was examined. Breast cancer cell lines were treated with concentrations of 0.075, 0.15, 0.3, 0.6, 1.2, 2.5, 5 and 10 mg/ml of Oscillatoria extract. The effect of extracts on the viability of cells was evaluated by MTT assay and alteration of caspase 3 gene expression was checked out by Real Time PCR. The results showed that the MCF7 cell viability was reduced in the presence of increasing concentration of the extract with significant differences compared to the control samples. The results of Real Time PCR showed that the expression of caspase 3 significantly increased after 24 h in comparison with the control group. Key words: Breast Cancer, Caspase 3, Oscillatoria. 1- M.Sc. Student in Microbial Biotechnology, Department of Biology, Damghan Branch, Islamic Azad University, Damghan, Iran. 2- Assistant Professor in Department of Biology, Rasht Branch, Islamic Azad University, Rasht, Iran. 3- Assistant Professor in Department of Biology, Damghan Branch, Islamic Azad University, Damghan, Iran. *Corresponding Author: